In our hands, one of these hardtoclone vectors is pegfp n1. Electroporation and rna interference in the rodent retina in. Clontech grants notforprofit entities a nonexclusive, royaltyfree. Department of anatomical sciences, faculty of medicine. The first plasmid was based on pegfpn1 vector clontech. Direct and rapid cytosolic delivery using cellpenetrating. The map, notes, and annotations on this page and in the sequencemap file are ed material. Electroporation and rna interference in the rodent retina. Welcome to vector database vector database is a digital collection of vector backbones assembled from publications and commercially available sources. Dopaminedependent neurodegeneration in rats induced by. For license information, please contact a licensing representative by phone at 650.
N and c are, as you thought the nterminal and cterminal tags, often it is a bit counterintuitive for these though, for example in the pegfpc1 plasmid, if you clone into this, the gfp will be nterminal to the insert i. Egfp from pegfpn1 vector clontech was then cloned into the modi. Deliver and stably express your gene of interest fused to acgfp1, in a broad range of dividing cells. Human hdac1 and hdac2 function in the dnadamage response to.
Ageidigested pegfpn1 clontech along with the annealed 2a oligonucleotides. Pegfp n1 vector fill online, printable, fillable, blank. This is a free resource for the scientific community that is compiled by addgene. Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. Clontech, heidelberg, germany as reporter alone, or in combination with 10 g pcdna3. Ctfam, or empty pegfpn1 vector employing optimum minimum essential medium with lipofectamine 2000 gibco, rockville, md, usa.
Sigmagen, rockville, usa and the empty vector plasmid pegfpn1 clontech, mountain view, usa into the sw480 cells. Construction of the pegfpn1p53mar vector and its effect on. Restriction map and multiple cloning site mcs of pegfpc1. Construction of a plasmid coding for green fluorescent protein. Detailed sequences and cloning information can be provided if requested. At its discretion, clontech grants notforprofit entities a nonexclusive, royaltyfree. They may not be used for any other purpose, including, but not limited to, use in drugs, in vitro. Pegfpn1 vector information pt30275 genbank accession u55762 catalog 60851 ase i sna b i apal i mcs pcmv ie puc ori ecoo109 i hsv tk poly a 591 671 pegfpn1 egfp 4. If you wish to digest the vector with this enzyme, you will need to transform the vector into a dam and make fresh dna.
So that if it is not spliced, the gfp will not express because of the the stop codon. What do you do if you have troubles with cloning into a. Functional expression of n a formyl peptide receptors in. Restriction map and multiple cloning site mcs of pegfp c1. The detailed protocols employed for our characterization work can be accessed via the link. Prostate cancer transfection by acoustic energy using pegfp. Li from pegfpn1 clontech, palo alto, ca by interrupting the enhanced green.
The final pcr product and pegfpn1 plasmid were each digested with nhei and. Shortly, the 720 bp fragment 67998 of pegfpn1 clontech was amplified and combined with the fragment coded his 6 and arg 8 sequences using the standard pcr technique. Mammalian expression vector, adds cterminal gfp tag. Mog was subcloned into the expression vector after murine igkappa chain vj2c signal peptide in the pegfpn1 between the dra iii and not1 restriction sites so as to construct pegfpn1mog vector. Treated cells were washed, incubated, and observed after 24 and 48 hours. Stable transfection of pegfpn1mog plasmid to utilize in. Mountain view, ca 94043 technical support us email. Forprofitentities wishing to use this product are required to obtain a license from clontech. Construction of a eukaryotic expression vector pegfpc1bmp2. Hightiter, helper virus free raav2 were generated with plasmid pdg 25 and purified as.
Egfp coding sequence was amplified from vector pegfpn1 clontech by pcr using. Two oligos 5 gaa ttc atg gcc ttc gcc cgc cgg ctc ctg cgc ggg cca ctg tcg ggg ccg ctg ctc ggg cgg cgc ggg gat cca3 and 5 gga tcc ccg cgc cgc ccg agc agc ggc ccc gac agt ggc ccg cgc agg agc cgg cgg gcg aag gcc atg aat tca3 were used to form a dsdna fragment encoding the. Receive the latest news, hot plasmids, discounts and more. Cultures were transfected with pegfpn1tfam, pegfpn1. The xba i site is methylated in the dna provided by clontech. Green fluorescent protein an overview sciencedirect topics. Interestingly, the migration of cells transfected with pegfpc1bmp2 plasmid was significantly increased at 36 and 48 h compared with the control group and the pegfpc1 group p clontech. World precision instruments with the following plasmids. Learn about the latest plasmid technologies and research tools. Pdf stable transfection of pegfpn1mog plasmid to utilize.
Egfp coding sequence was amplified from vector pegfpn1 clontech by pcr using pfu ultra stratagene using primers. The pgreen minigene was subsequently amplified using. Efficient multicistronic expression of a transgene in human. The pegfp, pgcn4wtegfp, pgcn4l20pegfp vectors were constructed as described for the analogous app vectors, using oligos 3 and 4 encoding residues 2 of gcn4wt and gcn4l20p, primer 2, vector pegfpn1 clontech and digestion with ecori and xhoi. Effect of targeted mammalian sterile 20like kinase 1. Ctfam was detected by western blot analysis as described above. The resultant fragment was digested by restriction enzymes bamhi and ecori and inserted into pev29b. First, the sw480 cells were cultured in sixwell plates until the cell confluence reached 6070%. We then used the pcr primers 59cgattctagagctaccggactcagatctcgag39and 59tgtggtatggctgattatgatc39 to transfer the cytomegalovirus promoter from pegfpn1 and nl into the paci site of the lentiviral vector fuw with nuclear localized green fluorescent protein funucgfpw. I sites are methylated in the dna provided by clontech laboratories, inc. Egfp was expressed in 70% of cells in the pegfp n1 hper2 group and 75% of cells in the pegfp n1 group, suggesting that pegfp n1 hper2 and pegfp n1 may be effectively transfected into mg63 cells, resulting in a high level of egfp expression.
The xba i and bcl i sites are methylated in the dna provided by bd biosciences clontech. Mog was subcloned into the expression vector after murine igkappa chain vj2c signal peptide in the pegfp n1 between the dra iii and not1 restriction sites so as to construct pegfp n1 mog vector. In our hands, one of these hardtoclone vectors is pegfpn1. The cdcrel1 coding sequence was fused to the egfp orf within pegfpn1 clontech, and the fragment encoding the fusion protein was subsequently transferred to psubpdgfwpre. Construction of the pegfpn1p53mar vector and its effect. Clontech, and the resulting plasmid was further confirmed by restriction digestion.
Regulation of golgi structure and function by arflike. Molecular and functional characterization of the stressinduced. Matthew welchs lab contains the insert actr3 and is published in j cell biol 1997 jul 28. Diminished production of human immunodeficiency virus. Subcutaneous implantation of dunning tumors was followed by injection of pegfpdna plasmid. For construction of pcmvgfp, pefgfp, and pubgfp, the promoter region of pcaggfp was replaced by the cytomegalovirus cmv promoter excised from pegfpn1, the human elongation factor ef 1. The results revealed that in the pegfp n1 hper2 and the pegfp n1 group, large numbers of mg63 expressed gfp.
If you wish to digest the vector with this enzyme you will need to transform the vector into a dam and make fresh dna. The mixture was then transferred to a 2mm electroporation cuvette and electroporated on the maximum efficiency setting. Prostate cancer transfection by acoustic energy using. This page is informational only this vector is not available from addgene please contact the manufacturer for further details. If you wish to digest the vector with these enzymes, you will need to transform the vector into a dam host and make fresh dna. Celltransfectionlogarithmicallygrowingu937cellswere resuspended in rpmi 1640 supplemented with 10% fcs. Human cytomegaloviral multifunctional protein kinase pul97. Restrictive enzyme analysis of pegfp mog by dra iii and not1. The plasmid pegfpn1, encoding enhanced green fluorescent protein egfp controlled by the cytomegalovirus cmv promoter clontech, was used as a source of the coding sequence of the pgreen minigene. The positive control was pegfpn1 clontech that contains cmv promoter. To obtain gfpdrp1k38a, the orf was amplified by pcr and cloned into the ecori and hindiii sites vector pegfpc1 clontech. Construction of recombinant pegfpn1hper2 plasmid and its. Dopaminedependent neurodegeneration in rats induced by viral.
Vector for fusing egfp to the cterminus of a partner protein. The cells were resuspended in 100 l of the nucleofector solution containing the plasmid. Restriction map and multiple cloning site mcs of pacgfp1n1 vector. N and c are, as you thought the nterminal and cterminal tags, often it is a bit counterintuitive for these though, for example in the pegfp c1 plasmid, if you clone into this, the gfp will be nterminal to the insert i. Development of a virosome vaccine for newcastle disease. The positive control was pegfpn1 clontech that contains cmv promoter and egfp reporter. Egfp fragment from pegfpn1 and the smaibstxi ires frag ment from. Single cellstage embryos were injected into yolk 0. For other reading frames, use pegfp n2 or pegfp n3. Arl1egfp, arl1t31negfp, arl1q71legfp and arl1g2a, q71legfp. Gfpfis1 was constructed by amplifying the orf of human fis1 from cdna of huvecs as template and cloning into the bglii and ecori sites of vector pegfpc1 clontech. May 10, 2019 single cellstage embryos were injected into yolk 0. With various cloning strategies my colleagues and i obtain a very few colonies, which often do not contain the vector with the insert. Effect of targeted mammalian sterile 20like kinase 1 regulation on proliferation and apoptosis of sw480 colorectal cancer cells.
One day before transfection, the cells were divided into three groups the recombinant plasmid pegfpc1bmp2 group, an empty vector pegfpc1 group, and a blank control group and were cultured in rpmi 1640 medium free of antibiotic. The results revealed that in the pegfpn1hper2 and the pegfpn1 group, large numbers of mg63 expressed gfp. Digital collection of empty plasmid backbones from publications and commercially available sources. Tumors were treated by acoustic energy with different parameter settings and the transfection. This is a free resource for the scientific community that is compiled by addgene this page is informational only this vector is not available from addgene please contact the manufacturer for further details. Egfp was expressed in 70% of cells in the pegfpn1hper2 group and 75% of cells in the pegfpn1 group, suggesting that pegfpn1hper2 and pegfpn1 may be effectively transfected into mg63 cells, resulting in a high level of egfp expression.
The coding sequences of wildtype arl1, arl1t31n and arl1q71l were also pcr cloned into this egfpcontaining pstar vector using ecori and bamhi sites to generate cterminal egfpfused arl1. The s58n dominant negative mutant of cdcrel1 is cloned into pegfpn1 in a similar manner except the mutant version of cdcrel. The cdcrel1 cdna is then excised from the pbluescript ks using hindiii and psti in an orientation of 5. Development of a virosome vaccine for newcastle disease virus. Construction of a eukaryotic expression vector pegfpc1. Cell classspecific regulation of neocortical dendrite and. Pegfp n1 vector information pt30275 genbank accession u55762 catalog 60851 ase i sna b i apal i mcs pcmv ie puc ori ecoo109 i hsv tk poly a 591 671 pegfp n1 egfp 4.
1243 1337 62 615 199 1476 976 62 747 1332 492 126 475 64 1390 817 1321 747 261 97 1405 487 1130 1367 570 659 438 1230 1292 649 1106 35 324 854 1011 1380 737 13 705 56 106